Research Article

 

Genetic Virulence Determinants and Antimicrobial Susceptibility Profile of Escherichia coli Isolated from Some Milk Products

 

Hala S.H. Salam1, Asmaa El-Sayed Zaghloul2, Esraa G. Hefny3, Essam I. Eltoukhy4, Abdelhafez Samir5, Abeer A.E. Shehata6*

1Department of Bacteriology, Mycology and Immunology, Faculty of Veterinary Medicine, Beni-Suef University, Beni-Suef, Egypt; 2Directorate of Veterinary Medicine, El-Fayoum, Egypt. 3Food Hygiene Department, Animal Health Research Institute, ARC Research Institute, Egypt; 4Biotechnology Department, Animal Health Research Institute, ARC, Egypt; 5NLQP, Animal Health, ARC, Egypt; 6Department of Bacteriology, Animal Health Research Institute, El-Fayoum Laboratory, El-Fayoum, Agricultural Research Center, Egypt.

 

Received | May 21, 2021; Accepted | July 05, 2021; Published | November 01, 2021

*Correspondence | Abeer Ahmed El-Sayed Shehata, Department of Bacteriology, Animal Health Research Institute, El-Fayoum Laboratory, El-Fayoum, Agricultural Research Center, Egypt; Email: aae_shehata@yahoo.com

Citation | Salam HSH, Zaghloul AE-S, Hefny EG, Eltoukhy EI, Samir A, Shehata AAE (2021). Genetic virulence determinants and antimicrobial susceptibility profile of Escherichia coli isolated from some milk products. Adv. Anim. Vet. Sci. 9(12): 2139-2146.

DOI | http://dx.doi.org/10.17582/journal.aavs/2021/9.12.2139.2146

ISSN (Online) | 2307-8316; ISSN (Print) | 2309-3331

Copyright © 2021 Salam et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

 

INTRODUCTION

 

Escherichia coli (E. coli) is Gram-negative bacilli belongs to the family Enterobacteriaceae. E. coli strains habitat intestinal tract (Lara et al., 2016) of both animal and humans normally as a non-pathogenic bacilli. Although most of E. coli strains are non-pathogenic, some strains are well armed with a variety of virulence factors that are diverge in accordance to the pathotype of E. coli.

 

Pathogenic E. coli have been classified into two categories; the diarrheagenic E. coli (DEC) and the extraintestinal pathogenic E. coli (ExPEC). Among the diarrheagenic E. coli, there are currently six categories including enteropathogenic E. coli (EPEC), enterotoxigenic E. coli (ETEC), enteroinvasive E. coli (EIEC), enteroaggregative E. coli (EAEC), diffusively adherent E. coli (DAEC) and enterohemorrhagic E. coli (EHEC)/Shiga toxin-producing E. coli (STEC) (Xiaodong, 2010). While extra-intestinal pathogenic E. coli (ExPEC) can be classified into three categories, namely, uropathogenic E. coli (UPEC) causing urinary tract infection (UTI), meningitis-associated E. coli (MNEC) and necrotoxigenic E. coli (NTEC) which produces cytotoxic necrotizing factor (CNF) (Kaper et al., 2004).

 

Milk and milk products including (yoghurt, kariesh cheese and cream) are consumed worldwide. They classified as sources of great biological value protein, principal vitamins and minerals (Pereira, 2014). Consumption of raw milk and raw-milk products are widely distributed in several countries as well as Egypt (Ayad et al., 2004). On the other hand, they are considered as source of possibly injurious bacteria to humans, such as pathogenic E. coli (Oliver et al., 2005). E. coli can gain access to milk via fecal contamination or via direct secretion (mastitis) from udder into milk (Stephan and Kühn, 1999).

 

STEC represent a dangerous public health problem worldwide initiating several human gastrointestinal tract diseases, including watery or bloody diarrhea, and may lead to a life-threatening disease, such as haemorrhagic colitis (HC), thrombotic thrombocytopenic purpura (TTP) and hemolytic uremic syndrome (HUS) (Kalid and Andreoli, 2018). STEC strains yield two powerful cytotoxins initiating tissue damage in humans called Shiga toxins or verotoxins (stx1/vt1 and stx2/vt2) (Li et al., 2017). Stx2 producing strains are frequently linked to more severe infections (Muniesa et al., 2004).

 

Other virulence factor likewise, outer membrane protein intimin that is encoded by the eaeA gene and firmly attach and form attaching and effacing lesions to intestinal epithelial cells (Awad et al., 2020). Another dangerous aspect of pathogenic E. coli is the presence of the astA gene encoding enteroaggregative heat-stable enterotoxin 1 (EAST1) which was primarily distinguished in EAEC (Dubreuil, 2017). Afterward, astA gene was detected in another DEC pathotypes including EPEC, ETEC, and EHEC (Ménard and Dubreuil, 2002). The astA gene possibly is a significant virulence factor in DEC which could be injurious to humans (Hinenoya et al., 2014).

 

The present study aimed at investigating some dairy products (yoghurt, kariesh cheese and cream) manufactured and retailed under market situations for the prevalence of E. coli, prevalent serogroups, presence of some virulence genes. Additionally, to study their antimicrobial susceptibility profile against antimicrobial agents of veterinary and humans medicine concern.

 

MATERIALS AND METHODS

 

Samples

A total of 155 samples from different milk byproducts (50 yoghurt, 55 kariesh cheese and 50 cream samples) were collected from different supermarkets, retail and dairy shops in Al-Fayoum governorate, Egypt during the period from August 2019 to February 2020. Samples were transferred in sterile containers to the laboratory and analyzed directly on arrival for the isolation of E. coli.

 

Isolation and identification of E. coli

Isolation and biochemical identification of E. coli was done according to Collee et al. (1996).

 

Detection of hemolytic activity of the identified E. coli isolates

The ability of E. coli isolates to produce different types of hemolysin was phenotypically investigated using sheep blood agar 7% (Collee et al., 1996).

 

Serogrouping of the isolated E. coli

Serogrouping of E. coli isolates recovered from different milk byproducts was performed in accordance to Ewing (1986). I was performed in Department of Serology, Animal Health Research Institute, Agricultural Research Center, Egypt.

 

In vitro antimicrobial susceptibility testing of the identified E. coli strains

The isolated E. coli strains were investigated for their antimicrobial susceptibility profile using disk diffusion test against different antimicrobial classes of veterinary and human being significance. Second generation cephalosporin (cefoxitin, 30µg); third generation cephalosporin (cefotaxime, 30 µg); penicillin-inhibitor combination (amoxicillin-clavulanic acid, 30 µg); aminoglycosides (gentamicin, 10 µg and streptomycin, 10 µg); tetracyclines (tetracycline 10 µg); quinolone (nalidixic acid 30 µg); fluoroquinolone (ciprofloxacin, 5 µg); carbapenem (imipenem, 10 µg); and folate pathway antagonist (trimethoprim-sulfamethoxazole, 25 µg). All antimicrobial disks were obtained from Oxoid, UK. The in vitro antimicrobial susceptibility profiling and results interpretation were performed according to CLSI (2019).

 

Table 1: Oligonucleotide primer sequences of target genes specific for E. coli.

 

Gene	Primer sequence (5'-3')	Amplicon size	Reference
stx1	ACACTGGATGATCTCAGTGG	614 bp	Dipineto et al. (2006)
	CTGAATCCCCCTCCATTATG
stx2	CCATGACAACGGACAGCAGTT	779 bp
	CCTGTCAACTGAGCAGCACTTTG
eaeA	ATGCTTAGTGCTGGTTTAGG	248 bp	Bisi-Johnson et al. (2011)
	GCCTTCATCATTTCGCTTTC
astA	CCATCAACACAGTATATCCGA	110 bp	Piva et al. (2003)
	GGTCGCGAGTGACGGCTTTGT

 

Table 2: PCR cycling conditions of the different primer sets.

 

Gene	Primary denaturation	Secondary denaturation	Annealing	Extension	No. of cycles	Final extension
stx1 and stx2	94˚C 5 min.	94˚C 30 sec.	58˚C 40 sec.	72˚C 45 sec.	35	72˚C 10 min.
eaeA	94˚C 5 min.	94˚C 30 sec.	51˚C 30 sec.	72˚C 30 sec.	35	72˚C 7 min.
astA	94˚C 5 min.	94˚C 30 sec.	55˚C 30 sec.	72˚C 30 sec.	35	72˚C 7 min.

 

Detection of some virulence genes in the prevalent E. coli serogroups isolated from dairy products using polymerase chain reaction (PCR)

Presence of astA, eaeA, stx1, and stx2 in the most prevalent serogroups of the isolated E. coli was done using PCR .

 

Preparation of DNA template

DNA template was obtained from overnight pure culture using QIAamp DNA Mini Kit (Catalogue no.51304) from Qiagen.

 

Amplification procedure

PCR reactions were performed in volumes of 25µL. Primers were obtained from Metabion (Germany) and master mix from Takara (Catalogue no. RR310). Table 1 reveals the used primer pairs for each gene, amplicon size and references used and Table 2 shows the cycling condition for each primer pairs. Ten microliters of the reaction products were analyzed by electrophoresis on 1% agarose gel containing ethidium bromide and results were visualized in a gel documentation system.

 

Statistical analysis

ANOVA test was used to investigate the prevalence of E. coli in different dairy products. Statistical significance was considered if p ≤ 0.05. All statistical comparisons were performed using IBM SPSS® Statistics software version 22.

 

RESULTS AND DISCUSSION

 

Prevalence of E. coli in different dairy products

E. coli prevalence (Table 3) differed according to the niche of dairy products. The highest prevalence (61.8%) was noted in kariesh cheese followed cream (56%), while the least prevalence was reported amongst yoghurt samples (12%). The overall prevalence of E. coli in the examined samples of the dairy products was 43.9%.

 

Table 3: Prevalence of E. coli isolated from dairy products.

 

Dairy product	Samples No.	E. coli
		No.	%*
Yoghurt	50	6	12.0§
Kariesh cheese	55	34	61.8
Cream	50	28	56.0
Total number	155	68	43.9

*%: Percentage was calculated according to the corresponding number of examined samples; §: Prevalence of E. coli in yoghurt was statistically lower than those reported in kariesh cheese and cream (p<0.05).

 

Prevalence of E. coli in yoghurt was statistically lower than those reported in kariesh cheese and cream (p<0.05). In contrast, kariesh cheese and cream E. coli prevalence difference was not statistically different (p>0.05).

 

Hemolytic activity of E. coli isolates

Alpha hemolysis was the only type of hemolysis phenotypically detected in E. coli isolated in the present study. Alpha-hemolytic activity was reported in 16 (23.5%) out of the inspected 68 isolates (one isolate recovered from cream and 15 isolates from kariesh cheese), while the remaining isolates were non-hemolytic i.e. gamma-hemolytic.

 

Serogrouping of E. coli isolates

Table 4 reveals the presence of 11 serogroups of E. coli amongst investigated 20 isolates that were selected to represent the examined dairy products (yoghurt, 5; kariesh cheese, 7 and cream, 8) under study (Table 4). Serogroups O55, O114 and 125 were reported in the investigated three dairy products.

 

Table 4: Serogrouping of E. coli isolates recovered from dairy products.

 

Product	No. of isolates	Serogroup
Yoghurt	5	O25
		O55
		O114
		O125
		O128
Kariesh cheese	7	O26
		O27
		O55
		O78
		O114
		O124
		O125
Cream	8	O26
		O27
		O55
		O78
		O86
		O114
		O125
		O148

 

Antimicrobial susceptibility testing of E. coli recovered from dairy products

The in vitro antimicrobial susceptibility testing revealed diverse susceptibility/resistance behavior of the investigated E. coli against the tested antimicrobial agents (Table 5). All 68 tested isolates were 100% sensitive to gentamicin, imipenem, and cefoxitin. On the other hand, the resistance rates against ampicillin, streptomycin, trimethoprim-sulfamethoxazole, cefotaxime, nalidixic acid, tetracycline and amoxicillin-clavulanic acid were 11.8, 10.3, 8.8, 7.4, 5.9, 4.4 and 4.4%, respectively. Additionally, multidrug resistance was noted in seven out of 68 (10.3%) of the inspected E. coli isolates.

 

Detection of some virulence genes in the prevalence E. coli serogroups isolated from dairy products

The presence of astA gene was confirmed in the isolates (100%) under test (Figure 1), while eaeA was only defined in five out of ten (50%) investigated isolates (Figure 2). Regarding to shiga toxins, stx1 and stx2 were only defined in one (10%) and two (20%) of the tested isolates, respectively (Figure 3). Results clarify all isolates harboring shiga toxin genes also harbored astA and eaeA genes.

 

 

 

 

Dairy products like yoghurt, cheese, and cream are widely consumed and markets have existed for them in many parts of the world for many generations. Dairy products over and above they are of high nutritional value for humans, they also offer an apt niche for bacterial growth likewise E. coli.

 

Table 5: Results of antimicrobial sensitivity test to 68 E. coli isolates from dairy products using the disk diffusion method.

 

Class	Antimicrobial agent	Sensitive		Intermediate		Resistant
		No.	%	No.	%	No.	%
Penicillin	Ampicillin	60	88.2	0	0	8	11.8
ß-lactam/β-lactamase inhibitor combinations	Amoxicillin-clavulanic acid	65	95.6	0	0	3	4.4
Third generation cephalosporins	Cefotaxime	63	92.6	0	0	5	7.4
Second generation cephalosporins	Cefoxitin	68	100	0	0	0	0
Carbapenems	Imipenem	68	100	0	0	0	0
Aminoglycosides	Gentamicin	68	100	0	0	0	0
	Streptomycin	54	79.4	7	10.3	7	10.3
Tetracyclines	Tetracycline	63	92.6	2	2.9	3	4.4
Quinolones	Ciprofloxacin	66	97.1	2	2.9	0	0
	Nalidixic acid	64	94.1	0	0	4	5.9
Folate pathway antagonist	Trimethoprim-sulfamethoxazole	61	89.7	1	1.5	6	8.8

%: Percentages were calculated in relation to the total number of tested isolates.

 

E. coli finds its way to milk and dairy products either, endogenously from the udder of diseased animal and or exogenously via direct contact with infected herds, environment or personnel (Farzana, 2009). In another consequence, E. coli is one of the main indicator organisms used for evaluating the quality of food (Anderson et al., 2006).

 

The present study revealed a diversity in the prevalence of E. coli in the examined dairy products (yoghurt, kariesh cheese and cream) (Table 3). The lowest prevalence was for yoghurt, 12% (6 isolates out of 50 samples) and it was significantly lower than those reported for kariesh cheese and cream (p<0.05). Low isolation rate of E. coli from yoghurt could be explained on the bases of the organic acid and low molecular weight antimicrobial substance produced by fermenting bacteria in yoghurt such as Lactobacillus spp. that showed in vitro antimicrobial activity against E. coli (Prabhurajeshwar and Chandrakanth, 2019).

 

Comparing the results of E. coli prevalence in yoghurt in the present study with other scholars’ result, identical prevalence of E. coli (12%) was noted by Okpalugo et al. (2008) in Abuja, Nigeria. On the other hand, Chaleshtori et al. (2017) reported closely matching isolation rate of E. coli (10%) from yoghurt in Iran. Higher isolation rates of E. coli form yoghurt were also reported 29.5, 44.8 and 88.0 % in Osun, Nigeria; El-Behera, Egypt and Mansoura city, Dakahlia Governorate, Egypt, respectively (El-Ansary, 2014; Abike et al., 2015; Kandil et al., 2018). Higher rates of E. coli from yoghurt in different studies could be attributed to the initial load of the milk before processing; usage of mastitic milk (Awadallah et al., 2016), improper sanitation of equipment used during processing; contamination after processing by unhygienic handling, packaging material (Pal et al., 2018) or to the storage temperature and time elapsed from manufacturer till sampling (Bachrouri et al., 2006).

 

On the other hand, the prevalences of E. coli in kariesh cheese and cream were 61.8 and 56%, respectively. Higher isolation rates of E. coli from kariesh cheese and cream could be attributed to the preparation of these products from mastitic milk (Awadallah et al., 2016) raw milk with high bacterial count, probiotic bacteria are not used in their preparation and also external contamination could occur at one or more points during processing (Deschenes et al., 1996). Non-statistical significant (p>0.05) of E. coli isolation rates from kariesh cheese and cream could be attributed to preparation of cream and kariesh cheese from the same milk source. Additionally, previous studies reported a range of 40-75% and 37.5-76.7% isolation rates of E. coli from kariesh cheese and cream in different regions in Egypt (Abd El-Tawab et al., 2020; Baraheem et al., 2007; El Nahas et al., 2015; Ibrahim et al., 2019).

 

Out of 20 E. coli isolates represented the dairy products under study 11 serogroups (Table 4) were identified (O25, O26, O27, O55, O78, O86, O114, O124, O125, O128, O148). El-Bagory et al. (2004) identified verotoxigenic E. coli O26 from the examined yoghurt samples. Also, Abike et al. (2015) found O26, O55, O86, O114, and O128 serogroups in raw milk, yoghurt and cheese. In a previous study, similar E. coli serogroups (O26, O55, and O114) were recovered from kariesh cheese and (O26, O55 and O114) form cream (El Nahas et al., 2015). Many scholars (Scott et al., 2009; Osman et al., 2013; Shehata and Salam, 2012; Awadallah et al., 2016) reported different E. coli serogroups either in diarrheic calves, healthy cattle or mastitic milk (O25, O26, O55, O78, 86, O114, O125, O148).

 

All isolates of E. coli recovered from dairy products in the present study were tested for their susceptibility behavior against 11 antimicrobial agents represented different antimicrobial classes of human being and veterinary concern in the region under study. The in vitro antimicrobial susceptibility testing revealed diverse susceptibility/resistance behavior of the investigated E. coli isolates against the tested antimicrobial agents (Table 5). All 68 tested isolates were 100% sensitive to gentamicin, imipenem, and cefoxitin. On the other hand, the resistance rates against ampicillin, streptomycin, trimethoprim-sulfamethoxazole, cefotaxime, nalidixic acid, tetracycline, and amoxicillin-clavulanic in descending order were 11.8, 10.3, 8.8, 7.4, 5.9, 4.4 and 4.4%, respectively. Side by side, growing of resistance was observed by the intermediate behavior of the investigated isolates against the tested antimicrobial agents. The percentages of the intermediate zones in ascending order were 1.5, 2.9 and 10.3% against trimethoprim-sulfamethoxazole, ciprofloxacin and streptomycin in turn. Additionally, multidrug resistance was noted in seven out of 68 (10.3%) of the inspected E. coli isolates.

 

Results divulged the correlation between the used antimicrobial agents in veterinary medicine and the reporting of resistance in isolates of veterinary origin and vice versa. Cefoxitin, imipenem and ciprofloxacin are of notorious use in medication of large animals and this could explain the results of 0.0% resistance records against these antimicrobial agents. Although the development of intermediate sensitivity behavior against ciprofloxacin and this could be due to the use of ciprofloxacin in broiler industry (Jónsdóttir and Kristinsson, 2008) that can later finds its way to the environmental niche either to humans or other animals. On the other hand, some antimicrobial classes showed higher rates of either resistance or intermediate behavior against the tested E. coli isolates likewise, penicillins, aminoglycosides, and tetracyclines, quinolones (first generation) and sulfonamides as these agents are of wide use in veterinary sectors and listed by the OIE as antimicrobial agents of veterinary importance (OIE, 2019). Furthermore, this could explain the prevalence of multidrug resistance amongst the tested isolates (10.3%).

 

Higher prevalence rates of resistance were reported in Mansoura city, Egypt against streptomycin, nalidixic, cefotaxime, tetracycline, trimethoprim-sulfamethoxazole, ampicillin, ciprofloxacin and gentamicin 100, 80, 60, 60, 60, 40, 40 and 20% in descending order (El-Baz, 2019). Also, Abd El-Tawab et al. (2020) reported 16.7% resistance amongst the E. coli tested against tetracycline in El-Gharbia Governorate, Egypt. There is a direct correlation between the abuse of antimicrobials and emergence of resistance amongst bacterial communities (Aly, 2013) and this could expound the metamorphosis in resistance profile of E. coli in different areas.

 

E. coli tempt its pathogenic actions through versatile sets of virulence elements that work in harmony to produce various illnesses in animals and humans. Phenotypic detection of hemolysis revealed the presence of α-hemolysin in 23.5% of the inspected isolates that is an exotoxin produced by E. coli and enhances virulence in clinical infections (May et al., 2000). Side by side, genotypic investigation revealed the presence of astA, eaeA, stx1 and stx2 genes in variable rates in ten E. coli isolates represented those isolated from dairy products under investigation (Figures 1, 2 and 3). All isolated had astA gene, eaeA was represented in five isolates while stx1 and stx2 were only noticed in two and one isolates, respectively. EAST1 induced by astA gene associates diarrheagenic E. coli in humans and animals and other scholars noted there presence even with non-diarrheagenic E. coli (Hinenoya et al., 2014) isolated from healthy cattle and swine. All shiga toxin genes (either stx1 or stx2) positive isolates were positive also for eaeA gene. This makes dairy products act as a potential source of STEC for humans as eaeA genes induce adhesion protein secretion required for intimate adherence of E. coli (Blank et al., 2002) that give chance for the cells of E. coli to produce shiga toxins to induce either watery or bloody diarrhea and may lead to a lethal disease such as HC, TTP and HUS (Khalid and Anderoli, 2018).

 

Researchers in different regions reported astA, eaeA, stx1 and stx2 genes in E. coli isolated from dairy products with variable prevalence rates (Elafify et al., 2020; Dehkordi et al., 2014) which could be attributed to the difference in the circulating serotypes in every study area.

 

CONCLUSIONS AND RECOMMENDATIONS

 

The present study points to yoghurt, kariesh cheese and cream as serious potential source of various E. coli pathotypes harboring virulence factors able to induce lethal diseases in humans. Moreover, multidrug resistant strains of E. coli that even if non-pathogenic will participate in establishing resistance in gastrointestinal tract bacterial community and environment. So, there is a fundamental need to follow the implementation of both good hygiene and manufacturing practices as well as application of strict hazards analysis and critical control point in dairy products industry for the sake of human safety.

 

Author’s Contribution

 

All authors contributed equally.

 

Conflict of interest

The authors have declared no conflict of interest.

 

REFERENCES

 

• Abd El-Tawab AA, Eid A, Khater D, Weheba MY (2020). The occurrence of pathogenic E. coli in some types of soft cheeses in the local market. Benha Vet. Med. J., 39(1): 5-10.

• Abike TO, Olufunke OA, Oriade KD (2015). Prevalence of multiple antibiotic resistant Escherichia coli serotypes in cow raw milk samples and traditional dairy products in Osun State, Nigeria. Br. Microbiol. Res. J., 5(2): 117-125.

• Aly SM (2013). Risk of antimicrobial misuse. Int. J. Health Sci., 7(1): V-VII.

• Anderson MA, Whitlock JE, Harwood VJ (2006). Diversity and distribution of Escherichia coli genotypes and antibiotic resistance phenotypes in feces of humans, cattle, and horses. Appl. Environ. Microbiol., 72(11): 6914-6922.

• Awad WS, El-Sayed AA, Mohammed FF, Bakry NM, Abdou NMI, Kamel MS (2020). Molecular characterization of pathogenic Escherichia coli isolated from diarrheic and in-contact cattle and buffalo calves. Trop. Anim. Health Prod., 52(6): 3173-3185.

• Awadallah MA, Ahmed HA, Merwad AM, Selim MA (2016). Occurrence, genotyping, shiga toxin genes and associated risk factors of E. coli isolated from dairy farms, handlers and milk consumers. Vet. J., 217: 83-88.

• Ayad EHE, Awad S, El-Attar A, De Jong C, El-Soda M (2004). Characterisation of Egyptian Ras cheese. 2. Flavour formation. Food Chem., 86(4): 553-561.

• Bachrouri M, Quinto EJ, Mora MT (2006). Kinetic parameters of Escherichia coli O157:H7 survival during fermentation of milk and refrigeration of homemade yoghurt. Int. Dairy J., 16(5): 474-481. https://doi.org/10.1016/j.idairyj.2005.06.002

• Baraheem OH, El-Shamy HA, Bakr WM, Gomaa NF (2007). Bacteriological quality of some dairy products (Kariesh cheese and ice cream) in Alexandria. Egypt Publ. Health Assoc., 82(5-6): 491-510.

• Bisi-Johnson MA, Obi CL, Vasaikar SD, Baba KA, Hattori T (2011). Molecular basis of virulence in clinical isolates of Escherichia coli and Salmonella species from a tertiary hospital in the Eastern Cape, South Africa. Gut. Pathog., 3(1): 9.

• Blank TE, Mougayrnuède J, Donnenberg MS (2002). Enteropathogenic Escherichia coli. In Escherichia coli virulence mechanisms of a versatile pathogen, Donnenberg M, (Eds.). Acad. Press, pp. 81-118. https://doi.org/10.1016/B978-012220751-8/50004-5

• Chaleshtori FS, Arani NM, Aghadavod E, Naseri A, Chaleshtori RS (2017). Molecular characterization of Escherichia coli recovered from traditional milk products in Kashan, Iran. Vet. World, 10(10): 1264. https://doi.org/10.14202/vetworld.2017.1264-1268

• Clinical and Laboratory Standards Institute (CLSI) (2019). Performance standards for antimicrobial disk susceptibility tests; Approved Standard, Nineteenth Edition.

• Collee JG, Fraser A, Marmion BP, Simmons A (1996). Practical Medical Microbiology. 14th ed. Mackie and McCartney. The English langue book society and Churchill living stone. Edinburgh and New York.

• Dehkordi FS, Yazdani F, Mozafari J, Valizadeh Y (2014). Virulence factors, serogroups and antimicrobial resistance properties of Escherichia coli strains in fermented dairy products. BMC Res. Notes, 7(1): 1-8. https://doi.org/10.1186/1756-0500-7-217

• Deschenes G, Casenave C, Grimont F, Desenclos JC, Benoit S, Collin M, Baron S, Mariani P, Grimont PA, Nivet H (1996). Cluster of cases of haemolytic uraemic syndrome due to unpasteurised cheese. Pediatr. Nephrol., 10(2): 203-205.

• Dipineto L, Santaniello A, Fontanella M, Lagos K, Fioretti A, Menna LF (2006). Presence of Shiga toxin‐producing Escherichia coli O157: H7 in living layer hens. Lett. Appl. Microbiol., 43(3): 293-295.

• Dubreuil JD (2017). EAST1 toxin: An enigmatic molecule associated with sporadic episodes of diarrhea in humans and animals. J. Microbiol., 57(7): 541-549.

• El-Nahas AW, Mohamed HA, El-Barbary HA, Mohamed HS (2015). Incidence of E. coli in raw milk and its products. Benha Vet. Med. J., 29(1): 112-117.

• Elafify M, Khalifa HO, Al-Ashmawy M, Elsherbini M, El-Latif AA, Okanda T, Matsumoto T, Koseki S, Abdelkhalek A (2020). Prevalence and antimicrobial resistance of Shiga toxin-producing Escherichia coli in milk and dairy products in Egypt. J. Environ. Sci. Health, Part B., 55(3): 265-272.

• El-Ansary MA (2014). Assessment of microbiological quality of yoghurt sold in El-Behera Governorate. Austral J. Vet. Sci., 43(1): 52-57.

• El-Bagory AM, Hammad AM (2004). Prevalence of E. coli O157: H7 and other Verotoxigenic E. coli in raw milk and some dairy products. Alex. J. Vet. Sci., 21(1): 34-40

• El-Baz AH (2019). Prevalence, molecular characterization and antimicrobial resistance of Vero toxigenic E. coli in fresh soft cheese, ice cream and yoghurt in Mansoura city. Alex. J. Vet. Sci., 62(1): 38-46.

• Ewing WH (1986). The genus Escherichia. In Edwards and Ewing’s Identification of Enterobacteriaceae. New York: Elsevier, pp. 93–134.

• Farzana K, Akhtar S, Jabeen F (2009). Prevalence and antibiotic resistance of bacteria in two ethnic milk-based products. Pak. J. Bot., 41(2): 935-943.

• Hinenoya A, Shima K, Asakura M, Nishimura K, Tsukamoto T, Ooka T, Hayashi T, Ramamurthy T, Faruque SM, Yamasaki S (2014). Molecular characterization of cytolethal distending toxin gene-positive Escherichia coli from healthy cattle and swine in Nara, Japan. BMC Microbiol., 14(1): 1-13.

• Ibrahim E, Elbarbary HA, Shawky NA, El-Sebay I (2019). Incidence and molecular characterization of Escherichia coli in some dairy products. Benha Vet. Med. J., 37(1): 102-106.

• Jónsdóttir K, Kristinsson KG (2008). Quinolone resistance in Gram negative rods in Iceland and association with antibiotic use. Laeknabladid, 94(4): 279-285.

• Kandil AA, Elhadidy M, El-Gamal A, Al-Ashmawy MA (2018). Identification of S. aureus and E. coli from dairy products intended for human consumption. Adv. Anim. Vet. Sci., 6(11): 509-513.

• Kaper JB, Nataro JP, Mobley HL (2004). Pathogenic Escherichia coli. Nat. Rev. Microbiol., 2(2): 123-140.

• Khalid M, Anderoli S (2018). Extrarenal manifestations of the hemolytic uremic syndrome associated with Shiga toxin-producing Escherichia coli (STEC HUS). Pediatr. Neprol., 34(12): 2495-2507.

• Lara VM, Carregaro AB, Santurio DF, Sá MFD, Santurio JM, Alves SH (2016). Antimicrobial susceptibility of Escherichia coli strains isolated from Alouatta spp. feces to essential oils. Evid. Based Complement. Altern. Med., (2016): 1-4. https://doi.org/10.1155/2016/1643762

• Li B, Liu H and Wang W (2017). Multiplex real-time PCR assay for detection of Escherichia coli O157:H7 and screening for non-O157 Shiga toxin-producing E. coli. BMC Microbiol., 9; 17(1): 215.

• May AK, Gleason TG, Sawyer RG, Pruett TL (2000). Contribution of Escherichia coli alpha-hemolysin to bacterial virulence and to intrapreritoneal alterations in peritonitis. Infect. Immun., 68(1): 176-183.

• Ménard LP, Dubreuil JD (2002). Enteroaggregative Escherichia coli heat-stable enterotoxin 1 (EAST1): a new toxin with an old twist. Crit. Rev. Microbiol., 28(1): 43-60.

• Muniesa M, Blanco JE, De Simón M, Serra-Moreno R, Blanch AR, Jofre J (2004). Diversity of stx2 converting bacteriophages induced from Shiga-toxin-producing Escherichia coli strains isolated from cattle. Microbiology, 150(9): 2959-2971. https://doi.org/10.1099/mic.0.27188-0

• OIE (2019). OIE list of antimicrobial agents of veterinary importance.

• Okpalugo J, Ibrahim K, Izebe KS, Inyang US (2008). Aspects of microbial quality of some milk products in Abuja Nigeria. Trop. J. Pharma. Res., 7(4): 1169-1177.

• Oliver SP, Jayarao BM, Almeida RA (2005). Foodborne pathogens in milk and the dairy farm environment: food safety and public health implications. Foodborne Pathog. Dis., 2(2): 115-129. https://doi.org/10.1089/fpd.2005.2.115

• Osman KM, Mustafa AM, Elhariri M, Abdelhamed GS (2013). The distribution of Escherichia coli serovars, virulence genes, gene association and combinations and virulence genes encoding serotypes in pathogenic E. coli recovered from diarrhoeic calves, sheep and goat. Transbound. Emerg. Dis., 60(1): 69-78.

• Pal M, Devrani M, Pintoo S (2018). Significance of hygienic processing of milk and dairy products. Madridge J. Food Tech., 3(2): 133-137.

• Pereira PC (2014). Milk nutritional composition and its role in human health. Nutrition, 30 (6): 619-627.

• Piva IC, Pereira AL, Ferraz LR, Silva RS, Vieira AC, Blanco JE, Blanco M, Blanco J, Giugliano LG (2003). Virulence markers of enteroaggregative Escherichia coli isolated from children and adults with diarrhea in Brasilia, Brazil. J. Clin. Microbiol., 41(5): 1827-1832.

• Prabhurajeshwar C, Chandrakanth K (2019). Evaluation of antimicrobial properties and their substances against pathogenic bacteria in-vitro by probiotic Lactobacilli strains isolated from commercial yoghurt. Clin. Nutr. Exp., 23: 97-115.

• Scott L, McGee P, Walsh C, Fanning S, Sweeney T, Blanco J, Karczmarczyk M, Earley B, Leonard N, Sheridan JJ (2009). Detection of numerous verotoxigenic E. coli serotypes, with multiple antibiotic resistance from cattle faeces and soil. Vet. Microbiol., 134(3-4): 288-293.

• Shehata AA, Salam HS (2012). Phenotypic characterization of E. coli isolated from farm animals with diarrhea: use of lectin as a non-specific immunostimulant. Int. J. Microbiol. Res., 3(3): 227-237.

• Stephan R, Kühn K (1999). Prevalence of verotoxin‐producing Escherichia coli (VTEC) in bovine coli mastitis and their antibiotic resistance patterns. Zentralbl Vet. B., 46(6): 423-427.

• Xiaodong X (2010). Pathogenic Escherichia coli in retail meats (Doctoral dissertation, Dissertation submitted to the Faculty of the Graduate School of the University of Maryland, College Park, in partial fulfillment of the requirements for the degree of Doctor of Philosophy).