Research Article

 

Prevalence and Virulence Genes of Vibrio and Aeromonas Species Isolated from Nile Tilapia and Mugil Fish Farms in Egypt

 

Ashraf A. Abd El-Tawab1, Fatma I. El-Hofy1, Gamal R. Hasb-Elnaby2, Manar E. El-Khayat1, Mennat Allah Refaey2*

1Department of Bacteriology, Immunology, and Mycology, Faculty of Veterinary Medicine, Benha University, Egypt; 2Agriculture Research Center, Animal Health Research Institute, Tanta Branch, Egypt.

 

Received | February 17, 2021; Accepted | June 12, 2021; Published | August 25, 2021

*Correspondence | Mennat Allah Refaey, Agriculture Research Center, Animal Health Research Institute, Tanta Branch, Egypt; Email: menat_allah_refaey@hotmail.com

Citation | El-Tawab AAA, El-Hofy FI, Hasb-Elnaby GR, El-Khayat ME, Refaey MA (2021). Prevalence and virulence genes of vibrio and Aeromonas species isolated from Nile tilapia and mugil fish farms in Egypt. Adv. Anim. Vet. Sci. 9(10): 1625-1631.

DOI | http://dx.doi.org/10.17582/journal.aavs/2021/9.10.1625.1631

ISSN (Online) | 2307-8316; ISSN (Print) | 2309-3331

Copyright © 2021 El-Tawab et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

 

INTRODUCTION

 

Aquaculture industry has expanded rapidly worldwide, which offers better economic income, job opportunities, and high-quality food products (Manage, 2018). Egypt is producing about 73.8% of total cultured fish in Africa and occupies the eighth level all over the world as it produces about 919585 tons of cultured fish that represents 1.54% of total cultured fish all over the world (FAO, 2012). Bacterial diseases seriously affect the fish industry, which may be attributed to the high death rate not only of farmed fish but also wild fish (Khalil and Abd El-Latif, 2013). Several Vibrio species are well recognized for their severity to cause fish disease, besides, causing mortality in reared fish is very common during early larval stages and can occur suddenly, leading sometimes to the death of the population (Thompson et al., 2004). The most studied Vibrio spp. known to be pathogenic to humans are Vibrio parahaemolyticus, Vibrio alginolyticus, and Vibrio vulnificus (You et al., 2016). Commonly, not all strains of V. parahaemolyticus are considered pathogenic (Dileep et al., 2003), the pathogenic ones that responsible for the onset of disease symptoms and outbreaks are characterized by the production of thermostable toxins and/or TDH-related hemolysin encoded by tdh and trh genes; respectively (World Health Organization and Food Agriculture Organization, 2011).

 

Aeromonas is the most prominent pathogen that can infect fish; many Aeromonas species are responsible for several fish diseases including A. hydrophila, A. caviae, and A. veronii biotype sobria. Aeromonas hydrophila infections are characterized by septicemia, ulcerative, hemorrhagic diseases, and significant mortalities in both wild and farmed freshwater and marine fish species. They don’t only cause mortality and cytotoxicity but also create uselessness of live fish as they are responsible for spots, lesions, and scale loss on the infected ones (Saikot et al., 2013). The pathogenicity of aeromonads has been linked to exotoxins that were grouped as aerolysin-hemolysins, cytolytic enterotoxins, or cytotonic enterotoxins (Kingombe et al., 1999). Vibrios and Aeromonas cause a great economic problem for aquaculture and human consumers in Egypt. Therefore, our study aimed for studying the prevalence of these bacteria in fresh Nile tilapia and Mugil cephalus isolated from the different fish farms at Kafr Elsheikh governorate and the molecular detection of some virulence genes.

 

MATERIALS AND METHODS

 

Ethical approval

All samples were taken according to the standard sample collection procedure without putting any stress on the fish sample. The current study was approved by the Ethical Committee for Medical Research at the faculty of veterinary sciences, Benha University and Animal Care Guidelines of the General Organization for Veterinary Services, Egypt.

 

Collection of samples

One hundred (n=100) clinically diseased fish samples,50 Nile tilapia (Oreochromis niloticus) and 50 mullet fish (M. cephalus), complaining of high mortality rate with signs of septicemia (unilateral or bilateral exophthalmia, skin ulcers, and hemorrhages) were collected from different fish farms at Kafr Elsheikh Governorate, Egypt at the period between January (2019) and October (2019). Each examined sample was taken alone in a strong sterile plastic bag with ½ of its volume water pumped with pressured oxygen, labeled and transferred alive with a minimum delay to the laboratory (Microbiology unit of Animal Health Research, Tanta branch, Egypt) for clinical and bacteriological examination. Three hundred and five samples were collected under strict aseptic conditions from apparently pathognomonic lesions in liver, kidney, spleen, heart, intestine, and gills from the 100 diseased fishes; 157 lesion samples from 50 Nile tilapia (O. niloticus) and 148 samples from 50 mullet fish (M. cephalus) and submitted to bacteriological and biochemical examination for isolation of Vibrio and Aeromonas species.

 

Bacteriological examination

Isolation and identification of Vibrio and Aeromonas species using the conventional cultural method

According to (Quinn et al., 2002) and (Markey et al., 2013) sterilized loops were introduced through seared lesions using a hot spatula. Then taken from lesions and inoculated into 1% peptone broth (Oxoid, UK) + 3%NaCl for Vibrio isolates and 1% peptone broth for Aeromonas isolates then incubated aerobically at 37°C for 18-24 hours. Loops from incubated cultured broth were streaked onto selective diagnostic agar media: cholera medium (TCBS, Oxoid) for Vibrio spp. and Aeromonas selective agar (BSIBG agar, HIMEDIA, M1890-55 G) for Aeromonas spp. and incubated for 24 hours at 37ºC. After that one separated typical colony from agar medium was picked up and transferred into the nutrient broth (Oxoid, UK) and was aerobically incubated at 37 ºC for 18-24 hrs, then 15% glycerol was added, gently mixed, and immediately preserved in a refrigerator at -85 ºC. The smears from the suspected pure colonies were stained with Gram’s stain and microscopically examined under the oil immersion lens. Vibrio spp. (Gram-negative, curved bacilli, comma shape) and Aeromonas spp. (Gram-negative, straight rods with a round end, non-capsulated and non-sporulated) were selected for further biochemical identification steps later. The biochemical identification of Vibrio and Aeromonas isolates was performed according to (Quinn et al., 2002; Nicky, 2004; Markey et al., 2013) by using catalase, oxidase, indole production, citrate utilization, urease test, triple sugar iron, and methyl red tests. Vibrio species were positive for oxidase; catalase, indole production, methyl red, citrate utilization except V. alginolyticus were citrate utilization negative, and ferment the glucose without gas, negative results for urease test and H2S production except V. alginolyticus produced H2S. Aeromonas hydrophila isolates were positive for oxidase, catalase, indole, H2S production, and ferment glucose with gas production. While negative for citrate utilization and methyl red tests. Aeromonas caviae are similar to A. hydrophila except for methyl red +ve, H2S –ve, and not ferment glucose.

 

Molecular identification of virulence genes in Vibrio and Aeromonas isolates

PCR was used for the confirmation of Vibrio species (5 random isolates) using species-specific genes (toxR gene for V. parahaemolyticus and collagenase gene for V. alginolyticus), as well as the detection of virulence genes of V. parahaemolyticus and A. hydrophila species by primers targeting different virulence genes including recA and trh genes for V. parahaemolyticus as well as aerA, hlyA, ahcytoen and fla genes for A. hydrophila (Table 1).

 

Extraction of DNA from Vibrio and Aeromonas isolates

It was performed by QIAamp® DNA Mini Kit (Catalogue no. 51304) according to the manufacturer’s instructions.

 

Amplification and cycling protocol of PCR for Vibrio and Aeromonas isolates

The cycling condition for each gene was prepared according to Emerald Amp GT PCR master mix (Takara, Cat PR310A) kit (Table 1). The amplification was performed on Eppendorf MasterCycler® (Eppendorf AG, Hamburg, Germany) in a total reaction volume of 25 µl containing 12.5 µl EmeraldAmp GT PCR Master Mix, 1 µl of each forward and reverse primers, 4.5 µl molecular biology grade water, and 6 µl test DNA.

 

Detection of PCR products

The PCR amplicons were analyzed by electrophoresis using a 1.5 % agarose gel in TBE buffer (45 mM Tris-borate, 1 mM EDTA, pH = 8.3). A 100 bp plus DNA Ladder (Qiagen, Germany, GmbH) was used to determine the fragment sizes.

 

RESULTS AND DISCUSSION

 

The prevalence of Vibrio and Aeromonas species in diseased fishes

Out of 100 diseased fish samples (50 from each Nile Tilapia and Mullet fish), 65 isolates of Vibrio species were isolated and biochemically identified. A total of 36 V. parahaemolyticus strains (55.4%) were isolated and identified, 20 (30.76%) from O. niloticus, and 16 (24.6%) from M. cephalus. Meanwhile, 22 V. alginolyticus strains (33.8%) were isolated, 13 (20.0%) from O. niloticus, and 9 (13.8%) from M. cephalus fish. Besides 7 V. cholera strains (10.8%) were isolated, 5 (7.7%) from O. niloticus, and 2 (3.1%) from M. cephalus (Table 2).

 

Table 1: Oligo-nucleotide primers and cycling conditions of the primers used in this study.

 

Bacterial spp.	Target genes	Oligonucleotide sequence (5′ → 3′)		Product size (base pairs)	Primary Denaturation	Amplification (35 cycles)			Final extension	References
						Secondary denaturation	Annealing	Extension
Vibrio alginolyticus	collagenase	F	CGAGTACAGTCACTTGAAAGCC	737	94˚C 5 min.	94˚C 1 min.	50˚C 1 min.	72˚C 1 min.	72˚C 10 min.	Abu-Elala et al., 2016
		R	CACAACAGAACTCGCGTTACC
Vibrio parahaemolyticus	ToxR	F	GTCTTCTGACGCAATCGTTG	368	96˚C 5 min.	94˚C 1 min.	63˚C 1.5min.	72˚C 1.5min.	72˚C 10 min.	Kim et al., 1999
		R	ATACGAGTGGTTGCTGTCATG
	recA	F	TGARAARCARTTYGGTAAAGG	793	95˚C 5 min.	95˚C 35 sec.	55˚C 1 min.	72˚C 1 min.	72˚C 7min.	Casandra et al., 2013
		R	TCRCCNTTRTAGCTRTACC
	trh	F	ACCTTTTCCTTCTCCWGGKTCSG	484	94˚C 5 min.	95˚C 1 min.	62˚C 1 min.	72˚C 1 min.	72˚C 2 min.
		R	RCCGCTCTCATATGCYTCGACAKT
Aeromonas hydrophila	fla	F	TCCAACCGTYTGACCTC	608	94˚C 5 min	94˚C 30 sec.	55˚C 40 sec.	72˚C 45 sec.	72˚C 10 min.	Nawaz et al., 2010
		R	GMYTGGTTGCGRATGGT
	aerA	F	CACAGCCAATATGTCGGTGAAG	326	94˚C 3 min.	94˚C 30 sec.	52˚C 30 sec.	72˚C 30 sec.	72˚C 10 min.	Singh et al., 2008
		R	GTCACCTTCTCGCTCAGGC
	hlyA	F	GGCCGGTGGCCCGAAGATACGGG	592	95˚C 5 min.	95˚C 2 min.	55˚C 1 min.	72˚C 1 min.	72˚C 7min.	Rozi et al., 2017
		R	GGCGGCGCCGGACGAGACGGGG
	Ahcytoen	F	GAGAAGGTGACCACCAAGAACAA	232	94˚C 5 min.	94˚C 30 sec.	56˚C 30 sec.	72˚C 1 min.	72˚C 10 min.	Cagatay and Şen, 2014
		R	AACTGACATCGGCCTTGAACTC

 

Table 2: Prevalence of Vibrio species isolated from examined fishes.

 

Type and number of fish samples	No. of examined fish samples	No. of examined lesion samples	Positive samples for Vibrio species						Total
			V. parahaemolyticus		V. alginolyticus		V. cholerae
			No.	%*	No.	%*	No.	%*	No.	%*
Nile tilapia (O. niloticus)	50	157	20	30.7	13	20.0	5	7.7	38	58.5
Mullet (M. cephalus)	50	148	16	24.6	9	13.8	2	3.1	27	41.5
Total	100	305	36	55.4	22	33.8	7	10.8	65	100

*Percentage in relation to the total number of Vibrio species isolated (65).

 

Table 3: Prevalence of Aeromonas species isolated from examined fishes.

 

Type and number of fish samples	No. of the examined fish samples	No. of examined lesion samples	Positive samples for Aeromonas species
			A. hydrophila		A. caviae		Total
			No.	%*	No.	%*	No.	%*
Nile tilapia (O. niloticus)	50	157	26	36.1	1	1.4	27	37.5
Mullet (M. cephalus)	50	148	39	54.2	6	8.3	45	62.5
Total	100	305	65	90.3	7	9.7	72	100.0

*Percentage in relation to the total number of Aeromonas species isolated (72).

 

Table 4: Types and prevalence of virulence genes in V. parahaemolyticus and A. hydrophila strains.

 

V. parahaemolyticus				Aeromonas hydrophila
recA		trh		fla		aerA		hlyA		ahcytoen
No.	%	No.	%	No.	%	No.	%	No.	%	No.	%
3	60.0	0	0.0	1	20.0	5	100.0	5	100.0	4	80.0

 

A total of 72 Aeromonas species were isolated and identified. Sixty-five A. hydrophila strains (90.3 %) were isolated, 26 (36.1%) from O. niloticus and 39(54.2%) from M. cephalus. Meanwhile, 7 A. caviae strains (9.7 %) were isolated, 1 (1.4%) from O. niloticus and 6 (8.3%) from M. cephalus (Table 3).

 

Molecular identification of Vibrio species using PCR

As a result of the molecular screening of 5 Vibrio species isolates using species-specific PCR (for V. parahaemolyticus (toxR gene) which generated at 368 bp and for V. alginolyticus (collagenase gene) which generated at 737bp), all five isolates were identified as V. parahaemolyticus. On the other hand, no V. alginolyticus isolates were identified (Figure 1).

 

 

Prevalence of some virulence genes among some isolated V. parahaemolyticus and A. hydrophila using PCR

PCR results showed the recA virulence gene was detected in three out of five random isolated V. parahaemolyticus. Meanwhile, the trh virulence gene was not detected in any of the tested 5 V. parahaemolyticus isolates (Figure 2). Also, five randomly selected A. hydrophila isolates were submitted for the screening of virulence genes by PCR. Results revealed that aerA and hlyA virulence genes were detected in all five random isolated A. hydrophila (Figure 3), Meanwhile, Ahcytoen was detected in 4 out of 5 A .hydrophila studied strains and fla virulence gene was detected in 1 out of 5 A. hydrophila isolates (Figure 4) (Table 4).

 

 

 

 

Discussion

 

The bacterial infection is one of the main obstacles to aquaculture, which leads to wide economic losses (Gophen, 2017). This study was planned for the determination of the prevalence of Vibrio and Aeromonas infection in Nile tilapia and Mullet fish farms and the molecular detection of some virulence genes. The obtained results of naturally infected fishes with Vibrio species indicating disease problem and the clinical signs varied from the dark coloration of skin with detached scales, and hemorrhage at the base of the fins with some erosion which support the findings of El-Bouhy et al. (2016), and Al-Taee et al. (2017) in Mugil and Tilapia. Vibrio parahaemolyticus was the most highly detected with a prevalence of 55.4 % and detected in Nile tilapia higher than mullet fish (Table 2) which may be due to the flesh texture of tilapia fish or their living habits. These results were in agreement with that obtained by El-Hady et al. (2015). The reverse result obtained by Abdelaziz et al. (2017) where V. alginolyticus recorded the highest prevalence of infection followed by V. parahaemolyticus is probably due to differences in fish species (Solea senegalensis and Mugil capito). Lower prevalence of V. parahaemolyticus was recorded by Abdelaziz et al. (2017); Ahmed et al. (2018), and Deng et al. (2020) which may be due to differences in the geographical origin or season. Five random Vibrio species isolates were further genetically verified by PCR for the detection of V. parahaemolyticus toxR gene. Kim et al. (1999) clarified that the V. parahaemolyticus toxR sequence is perfectly conserved among V. parahaemolyticus strains and always be an appropriate diagnostic test. In our study, all five isolates were identified as positive for the toxR gene as V. parahaemolyticus (Figure 1). These results agreed with that recorded by Al- Othrubi et al. (2014) and Ashrafudoulla et al. (2019) where the toxR gene was detected in all V. parahaemolyticus isolates. PCR results showed that the trh virulence gene was not detected in any of the tested 5 V. parahaemolyticus isolates indicating that the majority of isolates were found to be non-pathogenic to humans due to the lack of the pathogenic trh gene (Figure 2). These results agreed with that recorded by Mohamad et al. (2019) and Tan et al. (2020). Meanwhile, the recA virulence gene was detected in three out of five tested V. parahaemolyticus isolates (Figure 2). Theethakaew et al. (2013) identified frequent interspecies horizontal gene transfer and intra genetic recombination at the recA locus, which plays a great role in the apparent evolutionary classification of V. parahaemolyticus (Han et al., 2014). Aeromonas species cause severe diseases among fish and humans, as Motile Aeromonas Septicemia (MAS) in fish which is caused by A. hydrophila leading to high mortalities and high economic losses (Shayo et al., 2012). The results of clinical and postmortem examinations of studied fish were similar to those reported by Sayed (2017) and Algammal et al. (2020). The results of bacteriological examination (Table 3) revealed that A. hydrophila was isolated in mullet fish higher than Nile tilapia. These results agreed with these of Abd El Tawab et al. (2017), and Enany et al. (2019). Lower results were recorded by Gufe et al. (2019), and Algammal et al. (2020) which was probably due to differences in the geographical distribution. The aerA gene was amplified in all five random isolated A. hydrophila studied strains (Figure 3). These results were similar to Algammal et al. (2020), and Sonkol et al. (2020) who reported that the aerolysin (aerA) gene was detected in 100% of the isolates. Meanwhile, they have disagreed with that recorded by Nagar et al. (2011) and Ibrahim (2015) who failed to detect aerA virulent gene in these strains. The hlyA gene was amplified in all five random isolated A. hydrophila studied strains (Figure 3). Similar results were decided by Ruhil-Hayati et al. (2015) and Abd El Tawab et al. (2017). Lower results were reported by Sonkol et al. (2020). The Ahcytoen gene was amplified in 4 out of 5 A. hydrophila studied strains (Figure 4). Similar results were recorded by Abd El Tawab et al. (2017). The fla gene was amplified in 1 out of 5 A. hydrophila studied strains (Figure 4). Similar results were reported by Blaszk (2013) and Aravena et al. (2014). While higher results were reported by Nawaz et al. (2010) and Dahanayake et al. (2020).

 

CONCLUSIONS AND RECOMMENDATIONS

 

This study revealed that Vibrio and Aeromonas species contribute to the occurrence of severe economic losses in the aquaculture industry in Egypt that requires a constant detection of these isolates to reduce the spread of infection. The high frequency of virulence genes in the isolates obtained in this work revealed the important role of these virulence genes in the emergence of the clinical signs.

 

ACKNOWLEDGEMENTS

 

The authors appreciate the members of the Animal Health Research Institute, Tanta Branch, Egypt for their encouragement during the working and examination of the samples. We thank all staff members of the Department of Bacteriology, Immunology and Mycology, Faculty of Veterinary Medicine, Benha University.

 

Author’s Contribution

 

All authors contributed equally.

 

Conflict of interest

The authors have declared no conflict of interest.

 

REFERENCES

 

• Abd El-Tawab AA, Maarouf AAA, El-Hofy FI, El-Mougy EEA (2017). Detection of some virulence genes in A. hydrophila and A. caviae isolated from freshwater fishes at Qalubia Governorate. BVM J., 33(2): 489-503. http://www.bvmj.bu.edu.eg

• Abdelaziz M, Ibrahim MD, Ibrahim MA, Abu-Elala NM, Abdel-moneam DA (2017). Monitoring of different Vibrio species affecting marine fishes in Lake Qarun and Gulf of Suez: phenotypic and molecular characterization. Egypt. J. Aquat. Res., 43: 141–146.

• Abu-Elala NM, Abd-Elsalam RM, Marouf S, Abdelaziz M, Moustafa M (2016). Eutrophication, ammonia intoxication, and infectious diseases: Interdisciplinary factors of mass mortalities in cultured Nile tilapia. J. Aquat. Anim. Health, 145: 187–198.

• Ahmed HA, Rowaida Abdelazim S, Rasha Gharieb MA, Rasha Abou Elez MM, Maysa Awadallah AI (2018). Prevalence of antibiotic-resistant V. parahaemolyticus and V. cholera in fish and humans with special reference to viral typing and genotyping of V. parahaemolyticus. Slov. Vet. Res., 55(20): 251-262.

• Algammal AM, Mohamed MF, Basma Tawfik A, Hossein WN, El Kazzaz WM, Mabrok M (2020). Molecular typing, antibiogram, and PCR-RFLP based detection of Aeromonas hydrophila complex isolated from Oreochromis niloticus. Pathogens, 9: 238.

• Al-Taee AMR, Khamees NR, Al-Shammari NAH (2017). Vibrio Species isolated from farmed fish in Basra City in Iraq. J. Aquac. Res. Dev., 8: 472-475.

• Aravena RM, Inglis TJ, Riley TV, Chang BJ (2014). Distribution of 13 virulence genes among clinical and environmental Aeromonas spp. in Western Australia. Eur. J. Clin. Microbiol. Infect. Dis., 33(11): 1889-1895.

• Ashrafudoulla M, Mizan MFR, Park H, Byun KH, Lee N, Park SH, Ha SD (2019). Genetic relationship, virulence Factors, drug resistance profile, and biofilm formation ability of Vibrio parahaemolyticus isolated from Mussel. Front. Microbiol., 10(513).

• Blaszk BF (2013). Phenotypic and molecular characteristics of an Aeromonas hydrophila strain isolated from the River Nile. Microbiol. Res., 169: 547-552.

• Cagatay IT, Sen EB (2014). Detection of pathogenic Aeromonas hydrophila from rainbow trout (Oncorhynchus mykiss) farms in Turkey. Int.J. Agric. Biol., 16(2): 435-438.

• Casandra K, West G, Klein SL, Lovell CR (2013). High Frequency of Virulence Factor Genes tdh, trh, and tlh in Vibrio parahaemolyticus Strains isolated from a Pristine Estuary. Appl. Environ. Microbiol., 79(7): 2247–2252.

• Dahanayake PS, Hossain S, Wickramanayake MVKS, Heo GJ (2020). Prevalence of virulence and antimicrobial resistance genes in Aeromonas species isolated from marketed cockles (Tegillarca granosa) in Korea. Lett. Appl. Microbiol., 71(1): 94-101.

• Deng Y, Xu L, Chen H, Liu S, Guo Z, Cheng C, Ma H, Feng J (2020). Prevalence, virulence genes, and antimicrobial resistance of Vibrio species isolated from diseased marine fish in South China. Sci. Nat. Rep., 10: 14329.

• Dileep V, Kumar H, Kumar Y, Nishibuchi M, Karunasagar I, Karunasagar I (2003). Application of polymerase chain reaction for detection of Vibrio parahaemolyticus associated with tropical seafood and coastal environment. Lett. Appl. Microbiol., 36: 423-427.

• El-Bouhy Z, El-Nobi G, El-Murr A, Abd El-Hakim S (2016). Study on Vibriosis in Mugil Capito in El-Dakahlia and Damitta Governorates, Egypt. Abbassa Int. J. Aquat., 9(1).

• El-Hady MA, Nahla-El-khatib R, Abdel- Aziz ES (2015). Microbiological studies on Vibrio species isolated from some cultured fishes. Anim. Health Res. J., 3(1): 12-19.

• Enany ME, Eidaroos Abou ELAtta NHM, Eltamimy NM (2019). Microbial causes of summer mortality in farmed fish in Egypt. SCVMJ, XXIV (1). https://doi.org/10.21608/scvmj.2019.59198

• FAO, Food and Agriculture Organization (2012). The state of world fisheries and aquaculture 2012. Sales and marketing group Publishing Policy and Support Branch Office of Knowledge Exchange, Research and Extension FAO, Vialedelle Terme di Caracalla 00153 Rome, Italy.

• Gophen M (2017). Fish-Zooplankton, a predator-prey relations as a key factor for the design of zooplankton distribution sampling program in lake Kinneret, Israel. Open J. Modern Hydrol., 7: 209-222.

• Gufe C, Hodobo TC, Mbonjani B, Majonga O, Marumure J, Musari S, Jongi G, Makaya PV, Machakwa J (2019). Antimicrobial Profiling of Bacteria Isolated from fish sold at informal market in Mufakose, Zimbabwe. Int. J. Microbiol., Article ID 8759636, 7 pages. https://doi.org/10.1155/2019/8759636

• Han D, Tang H, Lu J (2014). Population structure of clinical Vibrio parahaemolyticus from 17 coastal countries, determined through multi-locus sequence analysis. PLoS One, 9(9).

• Ibrahim LSA (2015). Studies on virulent and antibiotic-resistant genes of Aeromonas species isolated from fish. Ph.D. (Bacteriology, Immunology, and Mycology) Fac. Vet. Med. Suez Canal University.

• Khalil RH, Abd El-Latif HM (2013). Effect of Vibrio alginolyticus on Mugil Capito. J. Arab. Aquacult. Soc., 8(1): 193-204.

• Kim YB, Okuda J, Matsumoto C, Takahashi T, Hashimoto S, Nishibuchi M (1999). Identification of Vibrio parahaemolyticus Strains at the Species Level by PCR Targeted to the toxR Gene. J. Clin. Microbiol., 37(4): 1173-1177.

• Kingombe CI, Huys G, Tonolla M, Albert MJ, Swings J, Peduzzi R, Jemmi T (1999). PCR detection, characterization, and distribution of virulence genes in Aeromonas spp. Appl. Environ. Microbiol., 65(12): 5293-5302.

• Manage PM (2018). Heavy use of antibiotics in aquaculture: Emerging human and animal health problems. A review. Sri Lanka J. Aquat. Sci., 23(1): 13-27.

• Markey BK, Leonard FC, Archambault M, Cullinane A, Maguire D (2013). Clinical veterinary microbiology. Second edition. MOSBY. Elsevier Ltd. Edinburgh London New York Oxford Philadelphia St Louis Sydney Toronto.

• Mohamad N, Amal MNA, Saad MZ, Yasin ISM, Zulkiply NA, Mustafa M, Nasruddin NS (2019). Virulence-associated genes and antibiotic resistance patterns of Vibrio spp. isolated from cultured marine fishes in Malaysia. BMC Vet. Res., 15(176).

• Nagar V, Shashidhar R, Bandekar JR (2011). Prevalence, characterization, and antimicrobial resistance of Aeromonas strains from various retail food products in Mumbai, India. J. Food Sci., 76(7): 486-492.

• Nawaz M, Khan SA, Khan AA, Sung K, Tran Q, Kerdahi K, Steele R (2010). Detection and characterization of virulence genes and integrons in Aeromonas veronii isolated from catfish. Food Microbiol., 27(3): 327-331.

• Nicky BB (2004). Bacteria from fish and other aquatic animals (a practical identification manual). CABI publishing is a division of CAB International. 106(85): 83–116. https://www.cabi.org/cabebooks/ebook/20043038092

• Quinn PJ, Markey BK, Carter ME, Donnelly WJ, Leonard FC (2002). Veterinary microbiology and microbial disease. First Published Blackwell Science Company, Iowa, State University Press.

• Rozi R, Rahayu K, Daruti DN (2017). Detection and analysis of hemolysin genes in Aeromonas hydrophila isolated from Gouramy (Osphronemusgouramy) by polymerase chain reaction (PCR). IOP Conf. Ser. Earth Environ. Sci., 137(1): 012001.

• Ruhil Hayati H, Hassan MD, Ong BL, Abdelhadi YM, Nur Hidayahanum H, Sharifah RM, Nora Faten AM, Kuttichantran S, Milud A (2015). Virulence genes detection of Aeromonas hydrophila originated from diseased freshwater fishes. Adv. Environ. Biol., 9(22): 22-26.

• Saikot FK, Zaman R, Khalequzzaman M (2013). Pathogenicity test of Aeromonas isolated from Motile Aeromonas Septicemia (MAS) infected Nile tilapia on some freshwater fish. Sci. Int., 1(9): 325-329.

• Sayed MOK (2017). Contribution toward prevention of motile Aeromonas septicemia in some freshwater fishes. M.V.Sc. thesis. Fac. Vet. Med. (Fish Diseases and Management) Beni-Suef Univ, Egypt.

• Shayo S, Mwita C, Hosea KM (2012). Virulence of Pseudomonas and Aeromonas bacteria recovered from Oreochromis niloticus (Perege) from Mtera hydropower Dam; Tanzania. Ann. Biol. Res., 3 (11): 5157-5161. http://scholarsresearchlibrary.com/AB

• Singh V, Rathore G, Kapoor D, Mishra BN, Lakra WS (2008). Detection of the aerolysin gene in Aeromonas hydrophila isolated from fish and pond water. Indian J. Microbiol., 48: 453-458.

• Sonkol RA, Torky HA, Khalil SA (2020). Molecular characterization of some virulence genes and antibiotic susceptibility of Aeromonas Hydrophila isolated from fish and water. AJVS. 64(2): 34-42.

• Tan CW, Rukayadi Y, Hasan H, Thung TY, Lee E, Rollon WD, Hara H, Kayali AY, Nishibuchi M, Radu S (2020). Prevalence and antibiotic resistance patterns of Vibrio parahaemolyticus isolated from different types of seafood in Selangor, Malaysia. Saudi J. Biol. Sci., 27 (6): 1602- 1608.

• Theethakaew C, Feil EJ, Castillo-Ramirez S (2013). Genetic relationships of Vibrio parahaemolyticus isolates from the clinical, human carrier, and environmental sources in Thailand, determined by multi-locus sequence analysis. Appl. Environ. Microbiol., 79(7): 2358–2370.

• Thompson FL, Iida T, Swings J (2004). Biodiversity of Vibrios. Microbiol. Mol. Biol. Rev., 68(3): 403-431.

• World Health Organization and Food Agriculture Organization (2011). Risk assessment of Vibrio parahaemolyticus in seafood: interpretative summary and technical report, World Health Organization.

• You KG, Bong CW, Lee CW (2016). Antibiotic resistance and plasmid profiling of Vibrio spp. in tropical waters of Peninsular Malaysia. Environ. Monit. Assess., 188(171).